pgama lentiviral expression vector Search Results


pgama lentiviral expression vector  (Addgene inc)
92
Addgene inc pgama lentiviral expression vector
Pgama Lentiviral Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/pGAMA-empty+(Plasmid+%2374755)/bio_rxiv__2024__06__29__601251-32-15-19
Average 92 stars, based on 1 article reviews
pgama lentiviral expression vector - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
lentiviral gfp vector  (OriGene)
94
OriGene lentiviral gfp vector
Lentiviral Gfp Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/pLenti-C-GFP+Lentiviral+Gene+Expression+Vector/pm36914635-307-20-26
Average 94 stars, based on 1 article reviews
lentiviral gfp vector - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
negative empty plasmid  (Shanghai GenePharma)
90
Shanghai GenePharma negative empty plasmid
Negative Empty Plasmid, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/empty+plasmid/pm40436527-66-8-17
Average 90 stars, based on 1 article reviews
negative empty plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
lentiviral vectors expressing the pgam5 gene  (Shanghai GenePharma)
90
Shanghai GenePharma lentiviral vectors expressing the pgam5 gene
Lentiviral Vectors Expressing The Pgam5 Gene, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/small+interfering+rna+targeting+pgam5/pm40436527-66-5-17
Average 90 stars, based on 1 article reviews
lentiviral vectors expressing the pgam5 gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
shcont tr30021 constructs  (OriGene)
96
OriGene shcont tr30021 constructs
Shcont Tr30021 Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm36914635-307-16-26
Average 96 stars, based on 1 article reviews
shcont tr30021 constructs - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
shrna mediated knockdown shrnas for pgam5  (OriGene)
91
OriGene shrna mediated knockdown shrnas for pgam5
Fig. 5 Activation of <t>KEAP1-PGAM5-AIFM1</t> signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.
Shrna Mediated Knockdown Shrnas For Pgam5, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/PGAM5+Human+shRNA+Plasmid+Kit/pm36914635-307-5-26
Average 91 stars, based on 1 article reviews
shrna mediated knockdown shrnas for pgam5 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
aifm1  (OriGene)
91
OriGene aifm1
Fig. 5 Activation of <t>KEAP1-PGAM5-AIFM1</t> signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.
Aifm1, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/AIF+(AIFM1)+Human+shRNA+Plasmid+Kit/pm36914635-307-13-26
Average 91 stars, based on 1 article reviews
aifm1 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
keap1  (OriGene)
94
OriGene keap1
Fig. 5 Activation of <t>KEAP1-PGAM5-AIFM1</t> signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.
Keap1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgama+lentiviral+expression+vector/KEAP1+Human+shRNA+Plasmid+Kit/pm36914635-307-11-26
Average 94 stars, based on 1 article reviews
keap1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: Activation Assay, Western Blot, Transfection, MTT Assay, Staining

Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: Activation Assay, Western Blot, Transfection, MTT Assay, Staining

Fig. 7 Oxeiptosis is involved in SNG-induced tumor suppression in vivo. Mice were subcutaneously inoculated with HT-29 cells into the right flanks and randomly divided into two groups (n = 5). Mice were injected intraperitoneally (i.p.) with 6 mg/kg/ SNG or an equal volume of vehicle. A Individual value plot showing the weights of HT-29 tumor xenografts in the vehicle and SNG treatment groups. Data shown are mean ± SD (n = 5) (**p < 0.01). B Tumor volumes of HT-29 xenograft tumors with the different time points (days) after exposure to SNG. Data shown are mean ± SD (n = 5) (***p < 0.001). C Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05 D The relative body weight was evaluated during the treatment. Data shown are mean ± SD (n = 5). E H&E- stained liver and kidney sections obtained from the mice treated with vehicle and SNG are shown. Scale bar: 100 µm.

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 7 Oxeiptosis is involved in SNG-induced tumor suppression in vivo. Mice were subcutaneously inoculated with HT-29 cells into the right flanks and randomly divided into two groups (n = 5). Mice were injected intraperitoneally (i.p.) with 6 mg/kg/ SNG or an equal volume of vehicle. A Individual value plot showing the weights of HT-29 tumor xenografts in the vehicle and SNG treatment groups. Data shown are mean ± SD (n = 5) (**p < 0.01). B Tumor volumes of HT-29 xenograft tumors with the different time points (days) after exposure to SNG. Data shown are mean ± SD (n = 5) (***p < 0.001). C Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05 D The relative body weight was evaluated during the treatment. Data shown are mean ± SD (n = 5). E H&E- stained liver and kidney sections obtained from the mice treated with vehicle and SNG are shown. Scale bar: 100 µm.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: In Vivo, Injection, Western Blot, Staining

Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: Activation Assay, Western Blot, Transfection, MTT Assay, Staining